Review



p stat2 y690  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Cell Signaling Technology Inc p stat2 y690
    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and <t>STAT2.</t> HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.
    P Stat2 Y690, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 186 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p-stat2+(y690)+rabbit/Phospho-Stat2+(Tyr690)+Rabbit+mAb/pmc12844614-30-132-135
    Average 96 stars, based on 186 article reviews
    p stat2 y690 - by Bioz Stars, 2026-09
    96/100 stars

    Images

    1) Product Images from "Physalin F Promotes AFG3L2-Mediated Degradation of VISA/MAVS to Suppress Innate Immune Response to RNA Virus"

    Article Title: Physalin F Promotes AFG3L2-Mediated Degradation of VISA/MAVS to Suppress Innate Immune Response to RNA Virus

    Journal: Pathogens

    doi: 10.3390/pathogens15010074

    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and STAT2. HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.
    Figure Legend Snippet: Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and STAT2. HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.

    Techniques Used: Stable Transfection, Transduction, Luciferase, Infection, Inhibition, Activation Assay, Reporter Assay, Quantitative RT-PCR, Control, Phospho-proteomics, Western Blot, Software

    Related Articles

    Bioprocessing:

    Article Title: The African swine fever virus p22 inhibits the JAK-STAT signaling pathway by promoting the TAX1BP1-mediated degradation of the type I interferon receptor
    Article Snippet: .. The rabbit anti-STAT1 monoclonal antibodies (MAb) (14994), rabbit anti-P-STAT1 (Y701) MAb (9167), rabbit anti-STAT2 MAb (72604), rabbit anti-p-STAT2 (Y690) MAb (88410), and rabbit anti-ATG7 MAb (8558T) were purchased from Cell Signaling Technology (Danvers, USA). .. The rabbit anti-p62 MAb (ab109012) and rabbit anti-KDEL MAb (ab176333, endoplasmic reticulum) were sourced from Abcam.

    Article Title: Enhanced Airway Epithelial Response to SARS-CoV-2 Infection in Children is Critically Tuned by the Cross-Talk Between Immune and Epithelial Cells
    Article Snippet: .. The following commercially available antibodies were used: rabbit monoclonal antibodies anti-p-IRF3(S396) (#4947S), anti p-STAT1 (Y701) (#7649S), anti-STAT2 (#72604S), anti p-STAT2(Y690) (#D3P2P) were purchased from Cell Signaling Technology. .. Mouse monoclonal antibodies anti-GAPDH (sc-47724) and anti-IRF3 (sc-3361) were from Santa Cruz Biotechnology.

    Sequencing:

    Article Title: STAT2 hinders STING intracellular trafficking and reshapes its activation in response to DNA damage
    Article Snippet: .. p-T404 STAT2 (Rabbit host) Wang et al, 2020 N/A p-Y245 STING (Rabbit host) Affinity Biosciences Cat:#CF2P HSV1 ICP0 (Mouse host) Abcam Cat: ab6513 Calreticulin(Rabbit host) Cell Signaling technology Cat:#12238 p-S366 hSTING (Rabbit host) Cell Signaling technology Cat:#19781 STAT2(Rabbit host) Cell Signaling technology Cat: #72604 p-S396 IRF3 (Rabbit host) Cell Signaling technology Cat:#29047 p-S172 IKKε (Rabbit host) Cell Signaling technology Cat:#8766 p-Y690 STAT2 (Rabbit host) Cell Signaling technology Cat:#88410 β-Tubulin (Rabbit host) Cell Signaling technology Cat:#2146 GAPDH (Rabbit host) Cell Signaling technology Cat:#5174 Actin (Rabbit host) Cell Signaling technology Cat:#3700 IRF3 (Rabbit host) Abcam Cat:ab68481 HA antibody(Mouse host) Abcam Cat:ab18181 STING antibody (Rabbit host) Abclonal technology Cat:A3575 Calnexin Antibody(Rabbit host) Gensript Cat: A01240 CD63(Mouse host) MBL International Corporation Cat:D263-3 IRF3 (Alexa Fluor® 488) Abcam Cat:ab204647 Human STING/TMEM173 Antibody R&D system AF6516 Oligonucleotides and sequence-based reagents h-18S rRNA-F, CTACCACATCCAAGGAAGCA This study Material and Method section h-18S rRNAR,TTTTTCGTCACTACCTCCCCG This study Material and Method section h-IFNβ-F, CAACTTGCTTGGATTCCTACAAAG This study Material and Method section h-IFNβ-R , TATTCAAGCCTCCCATTCAATTG This study Material and Method section h-IFNα-F, AATGACAGAATTCATGAAAGCGT This study Material and Method section h-IFNα-R, GGAGGTTGTCAGAGCAGA This study Material and Method section h-Ccl20-F, AAGTTGTCTGTGTGCGCAAATCC This study Material and Method section h-Ccl20-R, CCATTCCAGAAAAGCCACAGTTTT This study Material and Method section h-Ifit2F,TGCACTGCAACCATGAGTGAGAACA This study Material and Method section h-Ifit2R,GCCAGTAGGTTGCACATTGTGGC This study Material and Method section h-GAPDH-F, TCCCTGAGCTGAACGGGAAG This study Material and Method section h-GAPDH-R, GGAGGAGTGGGTGTCGCTGT This study Material and Method section h-IL6-F, AGACAGCCACTCACCTCTTCAG This study Material and Method section h-IL6-R, TTCTGCCAGTGCCTCTTTGCTG This study Material and Method section h-CXCL10-F, GGTGAGAAGAGATGTCTGAATCC This study Material and Method section h-CXCL10-R, GTCCATCCTTGGAAGCACTGCA This study Material and Method section HSV-ICP0-F, GTCGCCTTACGTGAACAAGAC This study Material and Method section HSV-ICP0-R, GTCGCCATGTTTCCCGTCTG This study Material and Method section Si-mSTAT2 Santa Cruz Biotechnology sc-37272-PR SgSTING sequence :GCTGGGACTGCTGTTAAACG This study Material and Method section Chemicals, enzymes and other reagents 2'3'-cGAMP InvivoGen Cat:tlrl-nacga23-02 Cisplatin Selleckchem Cat:NSC 119875 Polyethyleneimine(PEI) Mpbio Cat:195444 Lipofectamine 2000 Invitrogen Cat:11668019 GFP trap Chromotek Cat: gta-10 IFN-β PBL Interferon Source Cat:11415-1 .. & Frise, E. et al. (2012), GraphPad Prism version 8.3 for Windows, GraphPad Software www.graphpad.com

    Incubation:

    Article Title: Intertumoral heterogeneity impacts oncolytic vesicular stomatitis virus efficacy in mouse pancreatic cancer cells.
    Article Snippet: .. Membranes were then incubated in TBS-T with 5% BSA or milk with 0.02% sodium azide and a 1:5,000 dilution of rabbit polyclonal anti-VSV antibodies (raised against VSV virions), a 1:1,000 dilution of rabbit anti-phospho-STAT1 [catalog number 9177S, P-STAT1 (S727) Cell Signaling], a 1:1,000 dilution of rabbit anti-STAT1 (catalog number 14994T, D1K9Y, Cell Signaling), a 1:1,000 dilution of rabbit anti-phospho-STAT2 [catalog number PA5-97361, P-STAT2 (Y690), Invitrogen]. .. Starbright Blue 700 goat antirabbit (Bio-Rad, 12004161) or antimouse (Bio-Rad, 12004158) IgG fluorescent secondary antibodies at 1:5,000 dilutions were used for fluorescent western blotting detection using the Chemidoc MP imaging system from Bio-Rad.

    Luciferase:

    Article Title: Physalin F Promotes AFG3L2-Mediated Degradation of VISA/MAVS to Suppress Innate Immune Response to RNA Virus
    Article Snippet: .. Physalin F (TargetMol, Wellesley Hills, MA, USA, T8716); Dual-Specific Luciferase Assay Kit (Promega, Madison, WI, USA, E2490); puromycin (Thermo Fisher Scientific, Waltham, MA, USA); M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA, 28025-013); SYBR (Bio-Rad laboratories, Hercules, CA, USA); RiboLock RNase inhibitor, pyrophosphatase (Thermo Fisher Scientific, Waltham, MA, USA); protease inhibitor cocktail (Roche, Basel, Switzerland); polybrene (Millipore, Burlington, MA, USA); ClarityTM Western ECL Substrate (Bio-Rad, Hercules, CA, USA); ELISA kits for murine IFN-β (PBL Assay Science, Piscataway, NJ, USA, 42400), murine IL-6 (BioLegend, San Diego, CA, USA, 431304); mouse antibodies against HA (OriGene, Rockville, MD, USA, TA180128) and FLAG (Sigma-Aldrich, Burlington, MA, USA, F3165); mouse antibodies against β-Tubulin (ABclonal, Woburn, MA, USA, A12289); rabbit antibodies against FLAG (14793), Rig-I (3743), β-actin (5125), p-IRF3 S396 (4947), STAT1 (14994), p-STAT1 Y701 (9167) STAT2 (72604), and p-STAT2 Y690 (88410) (Cell Signaling Technology, Danvers, MA, USA); rabbit antibodies against TBK1 (ab40676), p-TBK1 S172 (ab109272), and p-IRF3 S386 (ab76493) (Abcam, Cambridge, UK); rabbit antibodies against AFG3L2 (14631-1-AP), TOM40 (18409-1-AP), TOM70 (14528-1-AP) (Proteintech, Rosemont, IL, USA), VISA (Bethyl Laboratories, Montgomery, TX, USA, A300-782A), and GFP (GeneTex, Irvine, CA, USA, GTX113617); and HRP-conjugated anti-FLAG monoclonal antibody (Sigma-Aldrich, A8592) were purchased from the indicated companies. ..

    Reverse Transcription:

    Article Title: Physalin F Promotes AFG3L2-Mediated Degradation of VISA/MAVS to Suppress Innate Immune Response to RNA Virus
    Article Snippet: .. Physalin F (TargetMol, Wellesley Hills, MA, USA, T8716); Dual-Specific Luciferase Assay Kit (Promega, Madison, WI, USA, E2490); puromycin (Thermo Fisher Scientific, Waltham, MA, USA); M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA, 28025-013); SYBR (Bio-Rad laboratories, Hercules, CA, USA); RiboLock RNase inhibitor, pyrophosphatase (Thermo Fisher Scientific, Waltham, MA, USA); protease inhibitor cocktail (Roche, Basel, Switzerland); polybrene (Millipore, Burlington, MA, USA); ClarityTM Western ECL Substrate (Bio-Rad, Hercules, CA, USA); ELISA kits for murine IFN-β (PBL Assay Science, Piscataway, NJ, USA, 42400), murine IL-6 (BioLegend, San Diego, CA, USA, 431304); mouse antibodies against HA (OriGene, Rockville, MD, USA, TA180128) and FLAG (Sigma-Aldrich, Burlington, MA, USA, F3165); mouse antibodies against β-Tubulin (ABclonal, Woburn, MA, USA, A12289); rabbit antibodies against FLAG (14793), Rig-I (3743), β-actin (5125), p-IRF3 S396 (4947), STAT1 (14994), p-STAT1 Y701 (9167) STAT2 (72604), and p-STAT2 Y690 (88410) (Cell Signaling Technology, Danvers, MA, USA); rabbit antibodies against TBK1 (ab40676), p-TBK1 S172 (ab109272), and p-IRF3 S386 (ab76493) (Abcam, Cambridge, UK); rabbit antibodies against AFG3L2 (14631-1-AP), TOM40 (18409-1-AP), TOM70 (14528-1-AP) (Proteintech, Rosemont, IL, USA), VISA (Bethyl Laboratories, Montgomery, TX, USA, A300-782A), and GFP (GeneTex, Irvine, CA, USA, GTX113617); and HRP-conjugated anti-FLAG monoclonal antibody (Sigma-Aldrich, A8592) were purchased from the indicated companies. ..

    Protease Inhibitor:

    Article Title: Physalin F Promotes AFG3L2-Mediated Degradation of VISA/MAVS to Suppress Innate Immune Response to RNA Virus
    Article Snippet: .. Physalin F (TargetMol, Wellesley Hills, MA, USA, T8716); Dual-Specific Luciferase Assay Kit (Promega, Madison, WI, USA, E2490); puromycin (Thermo Fisher Scientific, Waltham, MA, USA); M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA, 28025-013); SYBR (Bio-Rad laboratories, Hercules, CA, USA); RiboLock RNase inhibitor, pyrophosphatase (Thermo Fisher Scientific, Waltham, MA, USA); protease inhibitor cocktail (Roche, Basel, Switzerland); polybrene (Millipore, Burlington, MA, USA); ClarityTM Western ECL Substrate (Bio-Rad, Hercules, CA, USA); ELISA kits for murine IFN-β (PBL Assay Science, Piscataway, NJ, USA, 42400), murine IL-6 (BioLegend, San Diego, CA, USA, 431304); mouse antibodies against HA (OriGene, Rockville, MD, USA, TA180128) and FLAG (Sigma-Aldrich, Burlington, MA, USA, F3165); mouse antibodies against β-Tubulin (ABclonal, Woburn, MA, USA, A12289); rabbit antibodies against FLAG (14793), Rig-I (3743), β-actin (5125), p-IRF3 S396 (4947), STAT1 (14994), p-STAT1 Y701 (9167) STAT2 (72604), and p-STAT2 Y690 (88410) (Cell Signaling Technology, Danvers, MA, USA); rabbit antibodies against TBK1 (ab40676), p-TBK1 S172 (ab109272), and p-IRF3 S386 (ab76493) (Abcam, Cambridge, UK); rabbit antibodies against AFG3L2 (14631-1-AP), TOM40 (18409-1-AP), TOM70 (14528-1-AP) (Proteintech, Rosemont, IL, USA), VISA (Bethyl Laboratories, Montgomery, TX, USA, A300-782A), and GFP (GeneTex, Irvine, CA, USA, GTX113617); and HRP-conjugated anti-FLAG monoclonal antibody (Sigma-Aldrich, A8592) were purchased from the indicated companies. ..

    Western Blot:

    Article Title: Physalin F Promotes AFG3L2-Mediated Degradation of VISA/MAVS to Suppress Innate Immune Response to RNA Virus
    Article Snippet: .. Physalin F (TargetMol, Wellesley Hills, MA, USA, T8716); Dual-Specific Luciferase Assay Kit (Promega, Madison, WI, USA, E2490); puromycin (Thermo Fisher Scientific, Waltham, MA, USA); M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA, 28025-013); SYBR (Bio-Rad laboratories, Hercules, CA, USA); RiboLock RNase inhibitor, pyrophosphatase (Thermo Fisher Scientific, Waltham, MA, USA); protease inhibitor cocktail (Roche, Basel, Switzerland); polybrene (Millipore, Burlington, MA, USA); ClarityTM Western ECL Substrate (Bio-Rad, Hercules, CA, USA); ELISA kits for murine IFN-β (PBL Assay Science, Piscataway, NJ, USA, 42400), murine IL-6 (BioLegend, San Diego, CA, USA, 431304); mouse antibodies against HA (OriGene, Rockville, MD, USA, TA180128) and FLAG (Sigma-Aldrich, Burlington, MA, USA, F3165); mouse antibodies against β-Tubulin (ABclonal, Woburn, MA, USA, A12289); rabbit antibodies against FLAG (14793), Rig-I (3743), β-actin (5125), p-IRF3 S396 (4947), STAT1 (14994), p-STAT1 Y701 (9167) STAT2 (72604), and p-STAT2 Y690 (88410) (Cell Signaling Technology, Danvers, MA, USA); rabbit antibodies against TBK1 (ab40676), p-TBK1 S172 (ab109272), and p-IRF3 S386 (ab76493) (Abcam, Cambridge, UK); rabbit antibodies against AFG3L2 (14631-1-AP), TOM40 (18409-1-AP), TOM70 (14528-1-AP) (Proteintech, Rosemont, IL, USA), VISA (Bethyl Laboratories, Montgomery, TX, USA, A300-782A), and GFP (GeneTex, Irvine, CA, USA, GTX113617); and HRP-conjugated anti-FLAG monoclonal antibody (Sigma-Aldrich, A8592) were purchased from the indicated companies. ..

    Enzyme-linked Immunosorbent Assay:

    Article Title: Physalin F Promotes AFG3L2-Mediated Degradation of VISA/MAVS to Suppress Innate Immune Response to RNA Virus
    Article Snippet: .. Physalin F (TargetMol, Wellesley Hills, MA, USA, T8716); Dual-Specific Luciferase Assay Kit (Promega, Madison, WI, USA, E2490); puromycin (Thermo Fisher Scientific, Waltham, MA, USA); M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA, 28025-013); SYBR (Bio-Rad laboratories, Hercules, CA, USA); RiboLock RNase inhibitor, pyrophosphatase (Thermo Fisher Scientific, Waltham, MA, USA); protease inhibitor cocktail (Roche, Basel, Switzerland); polybrene (Millipore, Burlington, MA, USA); ClarityTM Western ECL Substrate (Bio-Rad, Hercules, CA, USA); ELISA kits for murine IFN-β (PBL Assay Science, Piscataway, NJ, USA, 42400), murine IL-6 (BioLegend, San Diego, CA, USA, 431304); mouse antibodies against HA (OriGene, Rockville, MD, USA, TA180128) and FLAG (Sigma-Aldrich, Burlington, MA, USA, F3165); mouse antibodies against β-Tubulin (ABclonal, Woburn, MA, USA, A12289); rabbit antibodies against FLAG (14793), Rig-I (3743), β-actin (5125), p-IRF3 S396 (4947), STAT1 (14994), p-STAT1 Y701 (9167) STAT2 (72604), and p-STAT2 Y690 (88410) (Cell Signaling Technology, Danvers, MA, USA); rabbit antibodies against TBK1 (ab40676), p-TBK1 S172 (ab109272), and p-IRF3 S386 (ab76493) (Abcam, Cambridge, UK); rabbit antibodies against AFG3L2 (14631-1-AP), TOM40 (18409-1-AP), TOM70 (14528-1-AP) (Proteintech, Rosemont, IL, USA), VISA (Bethyl Laboratories, Montgomery, TX, USA, A300-782A), and GFP (GeneTex, Irvine, CA, USA, GTX113617); and HRP-conjugated anti-FLAG monoclonal antibody (Sigma-Aldrich, A8592) were purchased from the indicated companies. ..

    other:

    Article Title: Immune–epithelial cell cross‐talk enhances antiviral responsiveness to SARS‐CoV ‐2 in children
    Article Snippet: The following commercially available antibodies were used: rabbit monoclonal antibodies anti‐p‐IRF3 (S396) (#4947S, RRID: AB_823547), anti p‐STAT1 (Y701) (#7649S, RRID: AB_10950970), anti‐STAT2 (#72604S, RRID: AB_2799824), anti p‐STAT2 (Y690) (#D3P2P, RRID: AB_2773718) were purchased from Cell Signaling Technology.



    Similar Products

    96
    Cell Signaling Technology Inc p stat2 y690
    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and <t>STAT2.</t> HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.
    P Stat2 Y690, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p-stat2+(y690)+rabbit/Phospho-Stat2+(Tyr690)+Rabbit+mAb/pmc12844614-30-132-135
    Average 96 stars, based on 1 article reviews
    p stat2 y690 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc rabbit anti p stat2 y690 mab
    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and <t>STAT2.</t> HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.
    Rabbit Anti P Stat2 Y690 Mab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p-stat2+(y690)+rabbit/Phospho-Stat2+(Tyr690)+Rabbit+mAb/pmc12266391-221-16-29
    Average 96 stars, based on 1 article reviews
    rabbit anti p stat2 y690 mab - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Cell Signaling Technology Inc d3b7 rabbit mab cell signaling technology 8826s p stat2 y690
    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and <t>STAT2.</t> HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.
    D3b7 Rabbit Mab Cell Signaling Technology 8826s P Stat2 Y690, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p-stat2+(y690)+rabbit/Phospho-Stat1+(Ser727)+Rabbit+mAb/pmc11046697__pnas__2402226121__sapp-203-23-26
    Average 95 stars, based on 1 article reviews
    d3b7 rabbit mab cell signaling technology 8826s p stat2 y690 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc anti p stat2 y690
    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and <t>STAT2.</t> HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.
    Anti P Stat2 Y690, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p-stat2+(y690)+rabbit/Phospho-Stat2+(Tyr690)+Rabbit+mAb/med_rxiv__2024__06__14__24308555-326-101-103
    Average 96 stars, based on 1 article reviews
    anti p stat2 y690 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc p y690 stat2
    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and <t>STAT2.</t> HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.
    P Y690 Stat2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p-stat2+(y690)+rabbit/Phospho-Stat2+(Tyr690)+Rabbit+mAb/pmc10120020__pnas__2216953120__sapp-62-60-64
    Average 96 stars, based on 1 article reviews
    p y690 stat2 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Cell Signaling Technology Inc p stat2 y690 r v cst 4441 rabbit
    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and <t>STAT2.</t> HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.
    P Stat2 Y690 R V Cst 4441 Rabbit, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p-stat2+(y690)+rabbit/Phospho-Stat2+(Tyr690)+Antibody/10__1523_slash_eneuro__0272___17__2017-128-164-165
    Average 95 stars, based on 1 article reviews
    p stat2 y690 r v cst 4441 rabbit - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    93
    R&D Systems rabbit anti p stat2
    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and <t>STAT2.</t> HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.
    Rabbit Anti P Stat2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p-stat2+(y690)+rabbit/Human+Phospho-STAT2+(Y690)+Antibody/pmc04619123-141-31-33
    Average 93 stars, based on 1 article reviews
    rabbit anti p stat2 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and STAT2. HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.

    Journal: Pathogens

    Article Title: Physalin F Promotes AFG3L2-Mediated Degradation of VISA/MAVS to Suppress Innate Immune Response to RNA Virus

    doi: 10.3390/pathogens15010074

    Figure Lengend Snippet: Identification of physalin F as an inhibitor of SeV-induced innate immune signaling. ( A ) Compounds of a natural small molecule library ( n = 903) were sub-pooled into 4 compounds/sub-pool. HEK293T cells (5 × 10 4 ) stably transduced with an ISRE luciferase reporter were treated with each of the sub-pools (5 μM for each compound) for 0.5 h, followed by infection with SeV for 8 h before luciferase assays (left dot plot, the dashed line indicates inhibition of SeV-induced ISRE activation by 50%). Forty-eight individual compounds from the 12 positive sub-pools (inhibition rate > 50%) were then tested for their effects on SeV-induced ISRE activation by reporter assays (middle dot plots, the dashed line indicates inhibition of SeV-induced ISRE activation by >98%). The arrows indicate the workflow. The candidate compound physalin F was further tested for its dose-dependent effects on SeV-induced ISRE activation by reporter assay. The IC 50 value was calculated from the dose–response curve. IC 50 = 1.0 μM, (95% CI: 0.8 to 1.1 μM). ( B ) Effects of physalin F on transcription of downstream genes induced by SeV in HEK293T and THP1 cells. HEK293T or THP 1 cells (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then infected with SeV for the indicated times before RT-qPCR analysis of mRNA levels of the indicated effector genes. GAPDH mRNA level was used as the internal control. ( C ) Effects of physalin F treatment on SeV-induced phosphorylation of TBK1, IRF3, STAT1, and STAT2. HEK293T or THP1 cells (1 × 10 6 ) were treated with the indicated concentrations of physalin F for 0.5 h and then infected with SeV for the indicated times. Immunoblotting analysis was performed with the indicated antibodies. The relative band intensities, which are normalized to the corresponding β-actin bands, are quantitated by densitometry analysis using ImageJ (1.53c) software and shown under the blots. Original Western blot images can be found in . ( D ) Effects of physalin F on IFN-γ induced transcription of the IRF1 gene in HEK293T cells. HEK293T cells (1 × 10 6 ) were treated with physalin F (0, 5 μM) for 0.5 h and then with IFN-γ for 6 h before RT-qPCR analysis of mRNA levels of the indicated antiviral genes. GAPDH mRNA level was used as the internal control. ( E ) Effects of physalin F on IFN-γ induced phosphorylation of STAT1. HEK293T (1 × 10 6 ) were treated with physalin F (0, 2.5, 5 μM) for 0.5 h and then with IFN-γ for 6 h. Immunoblotting analysis was performed with the indicated antibodies. Original Western blot images can be found in . Data shown in ( A ) (dose experiment), ( B , D ) are mean ± SD; n = 3 technical replicates. ns, not significant, * p < 0.05; ** p < 0.01. Experiments in ( B – E ) were repeated at least two times with similar results.

    Article Snippet: Physalin F (TargetMol, Wellesley Hills, MA, USA, T8716); Dual-Specific Luciferase Assay Kit (Promega, Madison, WI, USA, E2490); puromycin (Thermo Fisher Scientific, Waltham, MA, USA); M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA, 28025-013); SYBR (Bio-Rad laboratories, Hercules, CA, USA); RiboLock RNase inhibitor, pyrophosphatase (Thermo Fisher Scientific, Waltham, MA, USA); protease inhibitor cocktail (Roche, Basel, Switzerland); polybrene (Millipore, Burlington, MA, USA); ClarityTM Western ECL Substrate (Bio-Rad, Hercules, CA, USA); ELISA kits for murine IFN-β (PBL Assay Science, Piscataway, NJ, USA, 42400), murine IL-6 (BioLegend, San Diego, CA, USA, 431304); mouse antibodies against HA (OriGene, Rockville, MD, USA, TA180128) and FLAG (Sigma-Aldrich, Burlington, MA, USA, F3165); mouse antibodies against β-Tubulin (ABclonal, Woburn, MA, USA, A12289); rabbit antibodies against FLAG (14793), Rig-I (3743), β-actin (5125), p-IRF3 S396 (4947), STAT1 (14994), p-STAT1 Y701 (9167) STAT2 (72604), and p-STAT2 Y690 (88410) (Cell Signaling Technology, Danvers, MA, USA); rabbit antibodies against TBK1 (ab40676), p-TBK1 S172 (ab109272), and p-IRF3 S386 (ab76493) (Abcam, Cambridge, UK); rabbit antibodies against AFG3L2 (14631-1-AP), TOM40 (18409-1-AP), TOM70 (14528-1-AP) (Proteintech, Rosemont, IL, USA), VISA (Bethyl Laboratories, Montgomery, TX, USA, A300-782A), and GFP (GeneTex, Irvine, CA, USA, GTX113617); and HRP-conjugated anti-FLAG monoclonal antibody (Sigma-Aldrich, A8592) were purchased from the indicated companies.

    Techniques: Stable Transfection, Transduction, Luciferase, Infection, Inhibition, Activation Assay, Reporter Assay, Quantitative RT-PCR, Control, Phospho-proteomics, Western Blot, Software